How is GC content calculated?

It is the number of guanine and cytosine bases divided by the total number of valid bases, expressed as a percentage. Ambiguity codes and unknown characters are excluded from the denominator so they do not distort the result.

Why does GC content matter?

GC base pairs have three hydrogen bonds versus two for AT, so GC rich sequences are more thermally stable. This affects primer melting temperature, PCR conditions, secondary structure, and even how a region behaves during sequencing, making GC content a core design parameter.

How accurate is the melting temperature estimate?

The estimate uses the Wallace rule for oligos under fourteen bases and a basic GC formula for longer ones. These are quick approximations that ignore salt concentration and neighbouring bases, so use a nearest-neighbour model for precise primer design.

Does the tool handle RNA?

Yes. Uracil is counted as the AT-side partner of adenine, so RNA sequences give a correct GC content. You can paste DNA, RNA, or a mix, and any thymine or uracil is treated as a non-GC base.

What happens to spaces, numbers, or FASTA headers?

All non-letter characters are removed before counting, so line numbers, spaces, and newlines do not interfere. Stray letters that are not valid bases are counted separately as ambiguous and excluded from the GC calculation.

GC Content Calculator

GC content is one of the most-used numbers in molecular biology. This calculator counts the guanine and cytosine in any sequence you paste, reports it as a percentage, and adds base composition, length, and a quick melting temperature estimate for primer work.

How it works

The sequence is cleaned of everything that is not a letter, then each base is tallied. GC content is (G + C) / total valid bases x 100. AT content is the complement, with uracil counted on the AT side for RNA. Ambiguity codes are counted separately and left out of the percentage.

For melting temperature, short oligos under fourteen bases use the Wallace rule, Tm = 2(A+T) + 4(G+C), while longer sequences use the basic GC formula, Tm = 64.9 + 41(G+C-16.4)/N. Both are rough guides rather than precise predictions.

Worked example

The 20-base sequence ATGCGCGCTATAGGCCATGC contains 12 G or C bases out of 20, giving a GC content of 60 percent and an AT content of 40 percent. At 20 bases the long-oligo formula estimates a melting temperature near 58 °C.

Tips

Aim for primers in the 40 to 60 percent GC range for balanced behaviour, and keep a pair within a degree or two of each other in melting temperature. For final primer design always confirm with a salt-corrected nearest-neighbour calculator, since the simple formulas here ignore buffer conditions.